D17Mit126 Primer Detail MGI Mouse MGI:705094

D17Mit126 Primer Detail

Name

D17Mit126
Primer 1 Sequence

TATGTGGCATCTCTTTATTCATGA
Primer 2 Sequence

GCCAAGGATTGTCTGCCTTA
ID

MGI:705094
Product Size

137
Other IDs

D17Mit126 (BROAD)
Note

MIT assay: MT1224
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 126

J:39182 Xiao H, et al., Immunogenetics. 1997;45(4):274-7

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit126	a	small	B10.CAS3, B10.CAS4
		b	medium	C3H/HeJ
		c	large	C3.SW-H2^b, C57BL/6, C57BL/10

J:44833 Meagher S, et al., Hereditas. 1997;127(1-2):75-82

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit126	a	smallest	M. spretus
		b	larger	CAST/EiJ, CBA/J
		c	larger than above	A.CA-H2^f/Sn
		d	larger than above	C57BL/6J, DBA/2J, P/J, SJL/J, SM/J, SWR/J
		e	larger than above	RIIIS/J

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit126	a	125bp	SPRET/EiJ
	b	129bp	AKR/J, C3H/HeJ, CAST/EiJ
	c	137bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit126	a	137bp	129/SvW, A.CA/W, BALB/cW, C57BL/6W, C57BL/10W, DBA/2W
	D17Mit126	b	129bp	AKR/W, BN/aW, C3H/W, CBA/W

J:39182 Xiao H, et al., Fine mapping of 12 microsatellites and two new recombinants in the distal H2 complex on mouse chromosome 17. Immunogenetics. 1997;45(4):274-7

J:44833 Meagher S, et al., A microsatellite-based MHC genotyping system for house mice (Mus domesticus). Hereditas. 1997;127(1-2):75-82

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24