D17Mit128 Primer Detail MGI Mouse MGI:705096

D17Mit128 Primer Detail

Name

D17Mit128
Primer 1 Sequence

TGTCTGCCCCCTCTCATTC
Primer 2 Sequence

TTAACTGTGTCTTGTATCCCATGG
ID

MGI:705096
Product Size

146
Other IDs

D17Mit128 (BROAD)
Note

MIT assay: MT1134
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 128

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit128	a	133bp	BALB/cJ
	b	143bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	c	145bp	A/J, C3H/HeJ, DBA/2J
	d	157bp	CAST/EiJ
	e	161bp	SPRET/EiJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit128	c	larger	CBA/Kw
	D17Mit128	e	smaller	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24