About   Help   FAQ
D10Mit194 Primer Detail
Primers
  • Name
    D10Mit194
  • Primer 1 Sequence
    GATTGTTTGTAAAGACATGATCACG
  • Primer 2 Sequence
    AGATGTGGAATAGGAAGTATGATCG
  • ID
    MGI:705101
  • Product Size
    81
  • Other IDs
    D10Mit194 (BROAD)
  • Note
    MIT assay: MT3917
    Additional information: MIT STS Marker Data Files
Genes
D10Mit194 DNA segment, Chr 10, Massachusetts Institute of Technology 194
Polymorphisms
J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit194 a 80bp 129P2/Ola, 129S/SvEv, 129X1/Sv, 129X1/SvJ, C57BL/6J
b 82bp 129P1/ReJ, 129P3/J, 129P4/RrRkJ
c 88 129T1/Sv-Dnd1Ter
d 90bp C3HeB/FeJ
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit194 a 80bp 129X1/Sv
b 80, 94bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit194 a 70bp A/J, AKR/J, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
b 74bp CAST/EiJ
c 82bp B6.Cg-Lepob/+
d 84bp BALB/cJ, C3H/HeJ, DBA/2J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D10Mit194 a 94bp BALB/cW, C3H/W, CBA/W, DBA/2W
b 80bp 129/SvW, A.CA/W, AKR/W, BN/aW, C57BL/6W, C57BL/10W
References
J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory