D10Mit194 Primer Detail MGI Mouse MGI:705101

D10Mit194 Primer Detail

Name

D10Mit194
Primer 1 Sequence

GATTGTTTGTAAAGACATGATCACG
Primer 2 Sequence

AGATGTGGAATAGGAAGTATGATCG
ID

MGI:705101
Product Size

81
Other IDs

D10Mit194 (BROAD)
Note

MIT assay: MT3917
Additional information: MIT STS Marker Data Files

DNA segment, Chr 10, Massachusetts Institute of Technology 194

J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit194	a	80bp	129P2/Ola, 129S/SvEv, 129X1/Sv, 129X1/SvJ, C57BL/6J
		b	82bp	129P1/ReJ, 129P3/J, 129P4/RrRkJ
		c	88	129T1/Sv-Dnd1^Ter
		d	90bp	C3HeB/FeJ

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit194	a	80bp	129X1/Sv
Not Specified	D10Mit194	b	80, 94bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit194	a	70bp	A/J, AKR/J, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	b	74bp	CAST/EiJ
	c	82bp	B6.Cg-Lep^ob/+
	d	84bp	BALB/cJ, C3H/HeJ, DBA/2J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit194	a	94bp	BALB/cW, C3H/W, CBA/W, DBA/2W
	D10Mit194	b	80bp	129/SvW, A.CA/W, AKR/W, BN/aW, C57BL/6W, C57BL/10W

J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24