D10Mit198 Primer Detail MGI Mouse MGI:705107

D10Mit198 Primer Detail

Name

D10Mit198
Primer 1 Sequence

CATGTTTCTCTAGCCACCTGC
Primer 2 Sequence

TCCAGCCTTTGAGGTAGCC
ID

MGI:705107
Product Size

131
Other IDs

D10Mit198 (BROAD)
Note

MIT assay: MT2170
Additional information: MIT STS Marker Data Files

DNA segment, Chr 9, Massachusetts Institute of Technology 1006

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D9Mit1006	b	smaller	C57BL/6J
	c	166bp	C3HeB/FeJLe
	f	smallest	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit1006	a	133bp	CAST/EiJ
	b	145bp	B6.Cg-Lep^ob/+
	c	159bp	C57BL/6J
	d	166bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	e	170bp	AKR/J, NOD/MrkTac, NON/ShiLt
	f	174bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D9Mit1006	a	132bp	AKR/OlaHsd, C57BL/6JOlaHsd
	d	140bp	129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, C57BL/10, DBA/2J, SJL/J
	j	148bp	JF1
	p	144bp	PWB

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit1006	c	137bp	CBA/CaOlaHsd
	D9Mit1006	s	123bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24