About   Help   FAQ
D9Mit96 Primer Detail
Primers
  • Name
    D9Mit96
  • Primer 1 Sequence
    TGGTTTGCTTCAGCTCCTTT
  • Primer 2 Sequence
    GTTAGTGCACTGTCTCAGCCC
  • ID
    MGI:705117
  • Product Size
    205
  • Other IDs
    D9Mit96 (BROAD)
  • Note
    MIT assay: D916
    Additional information: MIT STS Marker Data Files
Genes
D9Mit96 DNA segment, Chr 9, Massachusetts Institute of Technology 96
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit96 a 147bp SPRET/EiJ
b 190bp AKR/J, B6.Cg-Lepob/+, C57BL/6J
c 194bp LP/J
d 204bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
e 212bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D9Mit96 a 204bp CBA/W
b 200bp A.CA/W, BALB/cW, C3H/W, DBA/2W
c 190bp 129/SvW
d 180bp AKR/W, BN/aW, C57BL/6W, C57BL/10W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory