About   Help   FAQ
D19Mit78 Primer Detail
Primers
  • Name
    D19Mit78
  • Primer 1 Sequence
    ATGCACAAGGCTACTTTCTATATCC
  • Primer 2 Sequence
    TCTGACCTTCACAGGAACCC
  • ID
    MGI:705132
  • Product Size
    134
  • Other IDs
    D19Mit78 (BROAD)
  • Note
    MIT assay: MT3202
    Additional information: MIT STS Marker Data Files
Genes
D19Mit78 DNA segment, Chr 19, Massachusetts Institute of Technology 78
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit78 a 95bp CAST/EiJ
b 140bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
c 148bp NOD/MrkTac
d 154bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D19Mit78 c 135bp CBA/CaOlaHsd
s 139bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
11/12/2024
MGI 6.24 		The Jackson Laboratory