About   Help   FAQ
D1Mit4 Primer Detail
Primers
  • Name
    D1Mit4
  • Primer 1 Sequence
    GCTACTGCTTTGGAGTCAGT
  • Primer 2 Sequence
    ATGACTTGAGCTCAGTCTCTG
  • ID
    MGI:705174
  • Product Size
    193
  • Other IDs
    D1Mit4 (BROAD)
  • Note
    MIT assay: M46
    Additional information: MIT STS Marker Data Files
Genes
D1Mit4 DNA segment, Chr 1, Massachusetts Institute of Technology 4
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit4 a largest C57BL/6, DBA/2
b smaller MSM/Ms
c smallest JF1
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit4 m 210bp MOLF/EiJ
s 168bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit4 a 168bp CAST/EiJ
b 170bp SPRET/EiJ
c 195bp NOD/MrkTac
d 197bp NON/ShiLt
e 200bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J
f 210bp LP/J
J:66473 Bagella L, et al., J Cell Biochem. 2000 Apr;78(1):170-8
Endonuclease Gene Allele Fragments Strains
D1Mit4 a 0.2kb AEJ/Gn
s 0.17kb M. spretus
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:66473 Bagella L, et al., Genomic organization, promoter analysis, and chromosomal mapping of the mouse gene encoding Cdk9. J Cell Biochem. 2000 Apr;78(1):170-8
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory