About   Help   FAQ
D1Mit3 Primer Detail
Primers
  • Name
    D1Mit3
  • Primer 1 Sequence
    TTTTTGTTTTCTTTTCTTTTCCC
  • Primer 2 Sequence
    CCCTCTTCTGGTTTCCACAT
  • ID
    MGI:705177
  • Product Size
    160
  • Other IDs
    D1Mit3 (BROAD)
  • Note
    MIT assay: M253
    Additional information: MIT STS Marker Data Files
Genes
D1Mit3 DNA segment, Chr 1, Massachusetts Institute of Technology 3
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D1Mit3 b smaller C57BL/6J
f larger FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit3 a largest JF1
b smaller DBA/2
c smallest C57BL/6, MSM/Ms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit3 a 160bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
b 185bp A/J, BALB/cJ, C3H/HeJ, CAST/EiJ, NOD/MrkTac, NON/ShiLt
c 187bp LP/J
d 200bp SPRET/EiJ
e 206bp AKR/J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D1Mit3 l larger LG/J
s smaller SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D1Mit3 a 206bp AKR/W
b 185bp 129/SvW, A.CA/W, BALB/cW, BN/aW, C3H/W
c 160bp C57BL/6W, C57BL/10W, CBA/W, DBA/2W
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D1Mit3 c lower CBA/Kw
e upper KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory