D14Mit47 Primer Detail MGI Mouse MGI:705183

D14Mit47 Primer Detail

Name

D14Mit47
Primer 1 Sequence

CACAGACTACCAGAATCTGGAGG
Primer 2 Sequence

CTCAGAACCATGTCTAAGGATGG
ID

MGI:705183
Product Size

96
Other IDs

D14Mit47 (BROAD)
Note

MIT assay: MPC1741
Additional information: MIT STS Marker Data Files

D14Mit47

DNA segment, Chr 14, Massachusetts Institute of Technology 47

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit47	m	194bp	MOLF/EiJ
Not Specified	D14Mit47	s	171bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit47	a	78bp	SPRET/EiJ
	b	86bp	CAST/EiJ
	c	98bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
	d	106bp	LP/J, NOD/MrkTac

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24