D14Mit42 Primer Detail MGI Mouse MGI:705188

D14Mit42 Primer Detail

Name

D14Mit42
Primer 1 Sequence

GTGTCACTTTCTCCCTGTGAG
Primer 2 Sequence

TTATACACATGTACATGCATGCA
ID

MGI:705188
Product Size

150
Note

MIT assay: M174

D14Mit42

DNA segment, Chr 14, Massachusetts Institute of Technology 42

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit42	m	160bp	MOLF/EiJ
Not Specified	D14Mit42	s	152bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit42	a	142bp	LP/J
	b	150bp	DBA/2J
	c	152bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	168bp	SPRET/EiJ
	e	176bp	CAST/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13