D10Mit70 Primer Detail MGI Mouse MGI:705196

D10Mit70 Primer Detail

Name

D10Mit70
Primer 1 Sequence

ACCTTTCTTCCTACCTACCTACCT
Primer 2 Sequence

TGGCACTTAGAAACTGATAAATGG
ID

MGI:705196
Product Size

145
Other IDs

D10Mit70 (BROAD)
Note

MIT assay: MPC640
Additional information: MIT STS Marker Data Files

D10Mit70

DNA segment, Chr 10, Massachusetts Institute of Technology 70

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit70	a	144bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	148bp	AKR/J, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
	c	154bp	CAST/EiJ
	d	176bp	A/J, BALB/cJ, DBA/2J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D10Mit70	a	188bp	A.CA/W, BALB/cW, DBA/2W
	b	156bp	AKR/W, BN/aW, C3H/W, CBA/W
	c	150bp	129/SvW, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24