About   Help   FAQ
D2Mit53 Primer Detail
Primers
  • Name
    D2Mit53
  • Primer 1 Sequence
    GTGGACATTCCCTGAGAAACA
  • Primer 2 Sequence
    GGGGTTTGATCAGCTCATGT
  • ID
    MGI:705230
  • Product Size
    148
  • Other IDs
    D2Mit53 (BROAD)
  • Note
    MIT assay: B342
    Additional information: MIT STS Marker Data Files
Genes
D2Mit53 DNA segment, Chr 2, Massachusetts Institute of Technology 53
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D2Mit53 c 150bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit53 a 142bp NON/ShiLt
b 148bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac
c 150bp C3H/HeJ, DBA/2J
d 152bp CAST/EiJ, SPRET/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory