D16Mit60 Primer Detail MGI Mouse MGI:705270

D16Mit60 Primer Detail

Name

D16Mit60
Primer 1 Sequence

AAATGGTCAGCCCTGAAGC
Primer 2 Sequence

TGCCTCACCCTTTGAAGTGT
ID

MGI:705270
Product Size

204
Other IDs

D16Mit60 (BROAD)
Note

MIT assay: MPC3
Additional information: MIT STS Marker Data Files

D16Mit60

DNA segment, Chr 16, Massachusetts Institute of Technology 60

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D16Mit60	a	215bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
Not Specified	D16Mit60	b	219bp	129X1/SvJ, CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit60	a	191bp	SPRET/EiJ
	b	201bp	C57BL/6J
	c	203bp	B6.Cg-Lep^ob/+
	d	207bp	A/J
	e	213bp	DBA/2J
	f	215bp	CAST/EiJ, NOD/MrkTac
	g	219bp	AKR/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24