D19Mit46 Primer Detail MGI Mouse MGI:705294

D19Mit46 Primer Detail

Name

D19Mit46
Primer 1 Sequence

ACCCTGCCCTCTCTCTCC
Primer 2 Sequence

GCACTCGCCAACTCAGGTAT
ID

MGI:705294
Product Size

113
Other IDs

D19Mit46 (BROAD)
Note

MIT assay: MMH224
Additional information: MIT STS Marker Data Files

D19Mit46

DNA segment, Chr 19, Massachusetts Institute of Technology 46

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit46	m	130bp	MOLF/EiJ
Not Specified	D19Mit46	s	117bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit46	a	115bp	C57BL/6J
	b	117bp	AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
	c	119bp	B6.Cg-Lep^ob/+
	d	123bp	C3H/HeJ, DBA/2J
	e	129bp	BALB/cJ
	f	133bp	A/J
	g	143bp	CAST/EiJ
	h	195bp	SPRET/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D19Mit46	c	larger	C58/J
	f	not given	FVB/NJ
	i	not given	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit46	c	122bp	CBA/CaOlaHsd
	D19Mit46	s	113bp	SWR/OlaHsd

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24