D19Mit41 Primer Detail MGI Mouse MGI:705297

D19Mit41 Primer Detail

Name

D19Mit41
Primer 1 Sequence

AGCCCTCCACCCAGTTTC
Primer 2 Sequence

TCTGGGGAAAAAGGATGAGA
ID

MGI:705297
Product Size

164
Other IDs

D19Mit41 (BROAD)
Note

MIT assay: MPC192
Additional information: MIT STS Marker Data Files

D19Mit41

DNA segment, Chr 19, Massachusetts Institute of Technology 41

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D19Mit41	b	larger than f	C57BL/6J
	c	174bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit41	a	128bp	SPRET/EiJ
	b	138bp	CAST/EiJ
	c	150bp	BALB/cJ, DBA/2J
	d	156bp	AKR/J
	e	160bp	B6.Cg-Lep^ob/+, C57BL/6J
	f	174bp	A/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit41	c	smaller	CBA/Kw
	D19Mit41	e	larger	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24