About   Help   FAQ
D19Mit41 Primer Detail
Primers
  • Name
    D19Mit41
  • Primer 1 Sequence
    AGCCCTCCACCCAGTTTC
  • Primer 2 Sequence
    TCTGGGGAAAAAGGATGAGA
  • ID
    MGI:705297
  • Product Size
    164
  • Other IDs
    D19Mit41 (BROAD)
  • Note
    MIT assay: MPC192
    Additional information: MIT STS Marker Data Files
Genes
D19Mit41 DNA segment, Chr 19, Massachusetts Institute of Technology 41
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D19Mit41 b larger than f C57BL/6J
c 174bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit41 a 128bp SPRET/EiJ
b 138bp CAST/EiJ
c 150bp BALB/cJ, DBA/2J
d 156bp AKR/J
e 160bp B6.Cg-Lepob/+, C57BL/6J
f 174bp A/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D19Mit41 c smaller CBA/Kw
e larger KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/02/2024
MGI 6.24
The Jackson Laboratory