D19Mit119 Primer Detail MGI Mouse MGI:705305

D19Mit119 Primer Detail

Name

D19Mit119
Primer 1 Sequence

CACCCACATACCTTGATT
Primer 2 Sequence

CTCTCTTTATCTCTCCTCTCTCT
ID

MGI:705305
Product Size

260
Other IDs

D19Mit119 (BROAD)
Note

MIT assay: MTH2706
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 19 Massachusetts Institute of Technology 119

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit119	a	281bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv, CD-1
Not Specified	D19Mit119	b	275bp	129X1/SvJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit119	a	264bp	B6.Cg-Lep^ob/+
	b	265bp	C57BL/6J
	c	276bp	C3H/HeJ, DBA/2J
	d	281bp	AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
	e	283bp	A/J, BALB/cJ
	f	287bp	CAST/EiJ, SPRET/EiJ

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit119	c	smaller	CBA/Kw
	D19Mit119	e	larger	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 08/02/2024 MGI 6.24