About   Help   FAQ
D7Mit15 Primer Detail
Primers
  • Name
    D7Mit15
  • Primer 1 Sequence
    GTGTGCACCCACATGGATAC
  • Primer 2 Sequence
    AGGGAAAGCACTTGACCATG
  • ID
    MGI:705315
  • Product Size
    139
  • Other IDs
    D7Mit15 (BROAD)
  • Note
    MIT assay: M47
    Additional information: MIT STS Marker Data Files
Genes
D7Mit15 DNA segment, Chr 7, Massachusetts Institute of Technology 15
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit15 a 123bp AKR/J, BALB/cJ
b 127bp CAST/EiJ
c 129bp SPRET/EiJ
d 134bp LP/J
e 138bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D7Mit15 a 138bp 129/SvW, A.CA/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
b 130bp BN/aW
c 123bp AKR/W, BALB/cW
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory