D7Mit15 Primer Detail MGI Mouse MGI:705315

D7Mit15 Primer Detail

Name

D7Mit15
Primer 1 Sequence

GTGTGCACCCACATGGATAC
Primer 2 Sequence

AGGGAAAGCACTTGACCATG
ID

MGI:705315
Product Size

139
Other IDs

D7Mit15 (BROAD)
Note

MIT assay: M47
Additional information: MIT STS Marker Data Files

D7Mit15

DNA segment, Chr 7, Massachusetts Institute of Technology 15

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit15	a	123bp	AKR/J, BALB/cJ
	b	127bp	CAST/EiJ
	c	129bp	SPRET/EiJ
	d	134bp	LP/J
	e	138bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D7Mit15	a	138bp	129/SvW, A.CA/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	b	130bp	BN/aW
	c	123bp	AKR/W, BALB/cW

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/03/2024 MGI 6.24