D7Mit12 Primer Detail MGI Mouse MGI:705318

D7Mit12 Primer Detail

Name

D7Mit12
Primer 1 Sequence

GCTGGGTTTATTCATTGCAA
Primer 2 Sequence

TCCAGCTCATGGGTAGAAGA
ID

MGI:705318
Product Size

197
Other IDs

D7Mit12 (BROAD)
Note

MIT assay: M23
Additional information: MIT STS Marker Data Files

D7Mit12

DNA segment, Chr 7, Massachusetts Institute of Technology 12

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit12	a	largest	JF1, MSM/Ms
Not Specified	D7Mit12	b	smaller	C57BL/6, DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit12	a	197bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac
	b	199bp	LP/J
	c	205bp	NON/ShiLt
	d	206bp	AKR/J, DBA/2J
	e	208bp	CAST/EiJ
	f	220bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D7Mit12	c	118bp	CBA/CaOlaHsd
	D7Mit12	s	125bp	SWR/OlaHsd

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24