About   Help   FAQ
D7Mit12 Primer Detail
Primers
  • Name
    D7Mit12
  • Primer 1 Sequence
    GCTGGGTTTATTCATTGCAA
  • Primer 2 Sequence
    TCCAGCTCATGGGTAGAAGA
  • ID
    MGI:705318
  • Product Size
    197
  • Other IDs
    D7Mit12 (BROAD)
  • Note
    MIT assay: M23
    Additional information: MIT STS Marker Data Files
Genes
D7Mit12 DNA segment, Chr 7, Massachusetts Institute of Technology 12
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit12 a largest JF1, MSM/Ms
b smaller C57BL/6, DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit12 a 197bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac
b 199bp LP/J
c 205bp NON/ShiLt
d 206bp AKR/J, DBA/2J
e 208bp CAST/EiJ
f 220bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D7Mit12 c 118bp CBA/CaOlaHsd
s 125bp SWR/OlaHsd
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory