D4Mit209 Primer Detail MGI Mouse MGI:705327

D4Mit209 Primer Detail

Name

D4Mit209
Primer 1 Sequence

CCTTGCTGGTTCTGGCTAAG
Primer 2 Sequence

CTATCTCCTGAGTTGCTCTGAGC
ID

MGI:705327
Product Size

122
Other IDs

D4Mit209 (BROAD)
Note

MIT assay: MT2072
Additional information: MIT STS Marker Data Files

D4Mit209

DNA segment, Chr 4, Massachusetts Institute of Technology 209

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit209	a	107bp	SPRET/EiJ
	b	113bp	NON/ShiLt
	c	121bp	A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac
	d	123bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	129bp	CAST/EiJ, LP/J

J:68682 Li X, et al., Mamm Genome. 2001 Jan;12(1):13-6

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit209	a	bigger	C57BL/6ByJ
	D4Mit209	b	smaller	129P3/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:68682 Li X, et al., High-resolution genetic mapping of the saccharin preference locus (Sac) and the putative sweet taste receptor (T1R1) gene (Gpr70) to mouse distal Chromosome 4. Mamm Genome. 2001 Jan;12(1):13-6

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24