D5Mit356 Primer Detail MGI Mouse MGI:705366

D5Mit356 Primer Detail

Name

D5Mit356
Primer 1 Sequence

CCATGCCCAGTCTGGTATCT
Primer 2 Sequence

TTTTACTTTCCACTAAGCATTCCC
ID

MGI:705366
Product Size

124
Other IDs

D5Mit356 (BROAD)
Note

MIT assay: MTH2090
Additional information: MIT STS Marker Data Files

D5Mit356

DNA Segment, Chr 5, Massachusetts Institute of Technology 356

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D5Mit356	a	110bp	A/J, AKR/J, BALB/cJ, LP/J
	b	124bp	C57BL/6J, SPRET/EiJ
	c	146bp	C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	d	160bp	CAST/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit356	c	upper	CBA/Kw
	D5Mit356	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24