D13Mit80 Primer Detail MGI Mouse MGI:705402

D13Mit80 Primer Detail

Name

D13Mit80
Primer 1 Sequence

CCACTACCCAATAATCTCTCTACTAGG
Primer 2 Sequence

ACCGAAAGATTGCACTGAGG
ID

MGI:705402
Product Size

146
Other IDs

D13Mit80 (BROAD)
Note

MIT assay: MMH266
Additional information: MIT STS Marker Data Files

D13Mit80

DNA segment, Chr 13, Massachusetts Institute of Technology 80

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit80	a	127bp	129X1/Sv
Not Specified	D13Mit80	f	127, 147bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit80	a	127bp	AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
	b	129bp	SPRET/EiJ
	c	147bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J
	d	151bp	CAST/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24