D1Mit57 Primer Detail MGI Mouse MGI:705410

D1Mit57 Primer Detail

Name

D1Mit57
Primer 1 Sequence

CCCATCATTTCAAAGGGAGA
Primer 2 Sequence

AGGAAAAAGGGATCTTCAAAGG
ID

MGI:705410
Product Size

207
Other IDs

D1Mit57 (BROAD)
Note

MIT assay: B538
Additional information: MIT STS Marker Data Files

D1Mit57

DNA segment, Chr 1, Massachusetts Institute of Technology 57

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit57	c	206bp	C3HeB/FeJLe
	D1Mit57	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit57	a	206bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	b	232bp	DBA/2J
	c	236bp	SPRET/EiJ
	d	272bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24