D15Mit92 Primer Detail MGI Mouse MGI:705434

D15Mit92 Primer Detail

Name

D15Mit92
Primer 1 Sequence

AGTCTCTCTCCCCCTTCTCTC
Primer 2 Sequence

TGCCACAAGCACAATAGTATCC
ID

MGI:705434
Product Size

147
Other IDs

D15Mit92 (BROAD)
Note

MIT assay: MMH255
Additional information: MIT STS Marker Data Files

D15Mit92

DNA segment, Chr 15, Massachusetts Institute of Technology 92

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit92	b	larger	C57BL/6J
	D15Mit92	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit92	a	131bp	CAST/EiJ
	b	139bp	A/J, C3H/HeJ, NON/ShiLt
	c	143bp	LP/J
	d	145bp	NOD/MrkTac
	e	147bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J, SPRET/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24