D11Mit130 Primer Detail MGI Mouse MGI:705439

D11Mit130 Primer Detail

Name

D11Mit130
Primer 1 Sequence

AGCATAAACAGATGTACATGCATATG
Primer 2 Sequence

CAGGCCCAGAACTCATCTCT
ID

MGI:705439
Product Size

200
Other IDs

D11Mit130 (BROAD)
Note

MIT assay: MT707
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 130

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit130	a	216bp	129X1/Sv
Not Specified	D11Mit130	f	196bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit130	a	195bp	NOD/MrkTac
	b	197bp	AKR/J, DBA/2J
	c	201bp	C57BL/6J
	d	203bp	B6.Cg-Lep^ob/+, NON/ShiLt
	e	205bp	A/J, CAST/EiJ
	f	209bp	BALB/cJ, SPRET/EiJ
	g	213bp	LP/J
	h	215bp	C3H/HeJ

J:104037 Grzmil P, et al., MGI Direct Data Submission. 2006;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit130	c	upper	CBA/Kw
	D11Mit130	k	lower	KE

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:104037 Grzmil P, et al., Mapping of mouse Chromosome 2, 11 STS markers in CBXE and EXCB RI strains. MGI Direct Data Submission. 2006;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24