D16Mit4 Primer Detail MGI Mouse MGI:705462

D16Mit4 Primer Detail

Name

D16Mit4
Primer 1 Sequence

AGTTCCAGGCTACTTGGGGT
Primer 2 Sequence

GAGCCCTCATTGCAAATCAT
ID

MGI:705462
Product Size

132
Other IDs

D16Mit4 (BROAD)
Note

MIT assay: M203
Additional information: MIT STS Marker Data Files

D16Mit4

DNA segment, Chr 16, Massachusetts Institute of Technology 4

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D16Mit4	b	smaller than f	C57BL/6J
	c	123bp	C3HeB/FeJLe
	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit4	a	123bp	C3H/HeJ, DBA/2J
	b	126bp	AKR/J
	c	130bp	CAST/EiJ
	d	132bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	145bp	SPRET/EiJ
	f	147bp	A/J
	g	149bp	BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D16Mit4	c	smaller	C58/J
	f	not given	FVB/NJ
	i	not given	I/LnJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit4	l	larger	LG/J
	D16Mit4	s	smaller	SM/J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit4	c	147bp	CBA/CaOlaHsd
	D16Mit4	s	145bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24