D17Mit164 Primer Detail MGI Mouse MGI:705495

D17Mit164 Primer Detail

Name

D17Mit164
Primer 1 Sequence

AGGCCCTAACATGTAGCAGG
Primer 2 Sequence

TATTATTGAGACTGTGGTTGTTGTTG
ID

MGI:705495
Product Size

133
Other IDs

D17Mit164 (BROAD)
Note

MIT assay: MT3318
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 164

J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit164	a	<0.126kb	B10.BR-H2^k
		b	0.136kb	B10.D2-H2^d, C57BL/6
		c	0.126kb	BALB.K-H2^k, BALB/cAnNCr, BALB/cByJ, BALB/cJ

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit164	b	136bp	C57BL/6J
		c	126bp	BALB/cJ
		s	123bp	129X1/SvJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit164	a	96bp	NOD/MrkTac
	b	110bp	SPRET/EiJ
	c	120bp	NON/ShiLt
	d	126bp	A/J, AKR/J, BALB/cJ, C3H/HeJ
	e	136bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J
	f	144bp	CAST/EiJ

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit164	a	smaller	129P3/J
	D17Mit164	s	larger	SJL/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit164	a	136bp	129/SvW, A.CA/W, C57BL/6W, C57BL/10W, DBA/2W
	D17Mit164	b	126bp	AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W

J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24