D3Mit283 Primer Detail MGI Mouse MGI:705512

D3Mit283 Primer Detail

Name

D3Mit283
Primer 1 Sequence

CTCAGCATTGTGTTTTGTATACAGC
Primer 2 Sequence

CATTCATTTTCATCAAAGTATATTTCC
ID

MGI:705512
Product Size

147
Other IDs

D3Mit283 (BROAD)
Note

MIT assay: MT4995
Additional information: MIT STS Marker Data Files

D3Mit283

DNA segment, Chr 3, Massachusetts Institute of Technology 283

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit283	a	123bp	SPRET/EiJ
	b	145bp	A/J, BALB/cJ, C3H/HeJ
	c	147bp	CAST/EiJ, LP/J, NOD/MrkTac, NON/ShiLt
	d	149bp	B6.Cg-Lep^ob/+, C57BL/6J
	e	151bp	DBA/2J
	f	161bp	AKR/J

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit283	c	lower	CBA/Kw
	D3Mit283	e	upper	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24