D1Mit415 Primer Detail MGI Mouse MGI:705566

D1Mit415 Primer Detail

Name

D1Mit415
Primer 1 Sequence

TTGGCACATGCCTACAACTC
Primer 2 Sequence

AGAACACCATATATTGTGCCCC
ID

MGI:705566
Product Size

155
Other IDs

D1Mit415 (BROAD)
Note

MIT assay: MTH794
Additional information: MIT STS Marker Data Files

D1Mit415

DNA segment, Chr 1, Massachusetts Institute of Technology 415

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit415	a	105bp	A/J, C3H/HeJ, LP/J, NON/ShiLt
	b	107bp	DBA/2J
	c	111bp	CAST/EiJ
	d	149bp	SPRET/EiJ
	e	157bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NOD/MrkTac

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit415	l	smaller	LG/J
	D1Mit415	s	larger	SM/J

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit415	c	upper	CBA/Kw
	D1Mit415	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 06/12/2024 MGI 6.13