D4Mit26 Primer Detail MGI Mouse MGI:705588

D4Mit26 Primer Detail

Name

D4Mit26
Primer 1 Sequence

CTGATGGTAGCAGAATCAGGC
Primer 2 Sequence

CGGTAGTTTTTCAAAGATCGTG
ID

MGI:705588
Product Size

209
Note

MIT assay: J1

D4Mit26

DNA segment, Chr 4, Massachusetts Institute of Technology 26

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit26	c	176bp	C3HeB/FeJLe
	D4Mit26	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit26	a	170bp	AKR/J
	b	174bp	BALB/cJ
	c	176bp	C3H/HeJ
	d	186bp	NON/ShiLt
	e	194bp	LP/J, NOD/MrkTac
	f	202bp	A/J, C57BL/6J, DBA/2J
	g	210bp	B6.Cg-Lep^ob/+
	h	214bp	SPRET/EiJ
	i	222bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit26	c	211bp	CBA/CaOlaHsd
	D4Mit26	s	180bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24