D10Mit35 Primer Detail MGI Mouse MGI:705597

D10Mit35 Primer Detail

Name

D10Mit35
Primer 1 Sequence

GTGCTGCTTCACTGTTTGGA
Primer 2 Sequence

CAAGCAAGGTAAATTGGAAAGG
ID

MGI:705597
Product Size

225
Other IDs

D10Mit35 (BROAD)
Note

MIT assay: B274
Additional information: MIT STS Marker Data Files

D10Mit35a	DNA segment, Chr 10, Massachusetts Institute of Technology 35a
D10Mit35b	DNA segment, Chr 10, Massachusetts Institute of Technology 35b

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D10Mit35a	m	250bp	MOLF/EiJ
Not Specified	D10Mit35a	s	236bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit35a	a	210bp	NON/ShiLt
	b	226bp	B6.Cg-Lep^ob/+
	c	228bp	AKR/J, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac
	d	236bp	A/J
	e	240bp	BALB/cJ, LP/J
	f	242bp	SPRET/EiJ
	g	250bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D10Mit35a	a	242bp	BALB/cW
	b	236bp	A.CA/W
	c	225bp	129/SvW, AKR/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/05/2024 MGI 6.24