D2Mit92 Primer Detail MGI Mouse MGI:705631

D2Mit92 Primer Detail

Name

D2Mit92
Primer 1 Sequence

TGTATGCACAGGTATTTCCCC
Primer 2 Sequence

TGAGGAAAGGGGATAAAATTTG
ID

MGI:705631
Product Size

149
Other IDs

D2Mit92 (BROAD)
Note

MIT assay: MPC420
Additional information: MIT STS Marker Data Files

D2Mit92

DNA segment, Chr 2, Massachusetts Institute of Technology 92

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D2Mit92	a	148bp	129X1/Sv
Not Specified	D2Mit92	f	168bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit92	a	148bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NON/ShiLt
	b	152bp	DBA/2J
	c	158bp	SPRET/EiJ
	d	162bp	CAST/EiJ
	e	196bp	NOD/MrkTac
	f	198bp	AKR/J
	g	200bp	A/J
	h	210bp	C3H/HeJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D2Mit92	c	not given	C58/J
	f	not given	FVB/NJ
	i	larger	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit92	c	141bp	CBA/CaOlaHsd
	D2Mit92	s	144bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24