D1Mit212 Primer Detail MGI Mouse MGI:705651

D1Mit212 Primer Detail

Name

D1Mit212
Primer 1 Sequence

TCTCATGAGGTGTGTGAGTTTG
Primer 2 Sequence

GGATCCCCTTGCTTCACTAA
ID

MGI:705651
Product Size

146
Other IDs

D1Mit212 (BROAD)
Note

MIT assay: MT1327
Additional information: MIT STS Marker Data Files

D1Mit212

DNA segment, Chr 1, Massachusetts Institute of Technology 212

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit212	a	149bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, DBA/2J
	b	168bp	LP/J
	c	172bp	CAST/EiJ
	d	214bp	A/J, C3H/HeJ, NON/ShiLt
	e	225bp	NOD/MrkTac

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D1Mit212	a	220bp	BN/aW
	b	214bp	A.CA/W
	c	200bp	129/SvW, C3H/W
	d	149bp	AKR/W, BALB/cW, C57BL/6W, C57BL/10W, CBA/W, DBA/2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/19/2024 MGI 6.24