D13Mit15 Primer Detail MGI Mouse MGI:705653

D13Mit15 Primer Detail

Name

D13Mit15
Primer 1 Sequence

AGGAACAGCAAGCTCTAAGGG
Primer 2 Sequence

GGCCTCCCAAGATATCATCA
ID

MGI:705653
Product Size

139
Other IDs

D13Mit15 (BROAD)
Note

MIT assay: D639
Additional information: MIT STS Marker Data Files

D13Mit15

DNA segment, Chr 13, Massachusetts Institute of Technology 15

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D13Mit15	a	138bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	140	129X1/SvJ
		c	138, 140, 146bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D13Mit15	a	114bp	CAST/EiJ
	b	138bp	BALB/cJ, NON/ShiLt
	c	142bp	A/J, C3H/HeJ, LP/J
	d	146bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac
	e	150bp	SPRET/EiJ

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/17/2024 MGI 6.24