About   Help   FAQ
D16Mit139 Primer Detail
Primers
  • Name
    D16Mit139
  • Primer 1 Sequence
    GTATGTAAGGAATGGTCAAATTCTTG
  • Primer 2 Sequence
    TCATTGTGATTGTGAAAGAATGC
  • ID
    MGI:705666
  • Product Size
    150
  • Other IDs
    D16Mit139 (BROAD)
  • Note
    MIT assay: MT3311
    Additional information: MIT STS Marker Data Files
Genes
D16Mit139 DNA segment, Chr 16, Massachusetts Institute of Technology 139
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit139 a 148bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NON/ShiLt
b 152bp CAST/EiJ
c 154bp NOD/MrkTac
d 172bp C3H/HeJ, SPRET/EiJ
e 174bp A/J, BALB/cJ, DBA/2J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D16Mit139 c 149bp CBA/CaOlaHsd
s 155bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory