D16Mit131 Primer Detail MGI Mouse MGI:705669

D16Mit131 Primer Detail

Name

D16Mit131
Primer 1 Sequence

TGGTGGTGGTGTTGATGGTA
Primer 2 Sequence

AAGACCATTTCTAATAAACAACACCC
ID

MGI:705669
Product Size

140
Other IDs

D16Mit131 (BROAD)
Note

MIT assay: MT3351
Additional information: MIT STS Marker Data Files

DNA segment, Chr 16, Massachusetts Institute of Technology 131

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D16Mit131	b	smallest	C57BL/6J
	c	180bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit131	a	144bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	168bp	SPRET/EiJ
	c	174bp	A/J
	d	176bp	AKR/J
	e	178bp	CAST/EiJ
	f	180bp	BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
	g	184bp	NON/ShiLt

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D16Mit131	c	smaller	C58/J
	f	not given	FVB/NJ
	i	not given	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit131	c	174bp	CBA/CaOlaHsd
	D16Mit131	s	173bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24