D14Mit170 Primer Detail MGI Mouse MGI:705685

D14Mit170 Primer Detail

Name

D14Mit170
Primer 1 Sequence

TGTGTATGATTGTGTGGGGG
Primer 2 Sequence

AGAAAGCAAACTTGCAAATATTCA
ID

MGI:705685
Product Size

144
Other IDs

D14Mit170 (BROAD)
Note

MIT assay: MT2599
Additional information: MIT STS Marker Data Files

DNA segment, Chr 14, Massachusetts Institute of Technology 170

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit170	a	122bp	CAST/EiJ
	b	142bp	DBA/2J
	c	146bp	A/J, BALB/cJ, NOD/MrkTac
	d	150bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, SPRET/EiJ
	e	152bp	NON/ShiLt
	f	162bp	LP/J

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D14Mit170	c	smaller	C58/J
	f	not given	FVB/NJ
	i	larger	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D14Mit170	c	153bp	CBA/CaOlaHsd
	D14Mit170	s	145bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D14Mit170	a	154bp	BALB/cW
	b	150bp	129/SvW, AKR/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
	c	146bp	A.CA/W
	d	142bp	DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24