About   Help   FAQ
D14Mit170 Primer Detail
Primers
  • Name
    D14Mit170
  • Primer 1 Sequence
    TGTGTATGATTGTGTGGGGG
  • Primer 2 Sequence
    AGAAAGCAAACTTGCAAATATTCA
  • ID
    MGI:705685
  • Product Size
    144
  • Other IDs
    D14Mit170 (BROAD)
  • Note
    MIT assay: MT2599
    Additional information: MIT STS Marker Data Files
Genes
D14Mit170 DNA segment, Chr 14, Massachusetts Institute of Technology 170
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit170 a 122bp CAST/EiJ
b 142bp DBA/2J
c 146bp A/J, BALB/cJ, NOD/MrkTac
d 150bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, SPRET/EiJ
e 152bp NON/ShiLt
f 162bp LP/J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D14Mit170 c smaller C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D14Mit170 c 153bp CBA/CaOlaHsd
s 145bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D14Mit170 a 154bp BALB/cW
b 150bp 129/SvW, AKR/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
c 146bp A.CA/W
d 142bp DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory