D2Mit266 Primer Detail MGI Mouse MGI:705693

D2Mit266 Primer Detail

Name

D2Mit266
Primer 1 Sequence

GGATCTATGCTCCATTTTAATTGC
Primer 2 Sequence

TCATCTTCTGGTTTCAACATGG
ID

MGI:705693
Product Size

127
Other IDs

D2Mit266 (BROAD)
Note

MIT assay: MT2735
Additional information: MIT STS Marker Data Files

D2Mit266	DNA segment, Chr 2, Massachusetts Institute of Technology 266
D11Mit1007	DNA segment, Chr 11, Massachusetts Institute of Technology 1007

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D2Mit266	a	130bp	129X1/Sv
Not Specified	D2Mit266	f	130, 150bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit266	c	138bp	C3HeB/FeJLe
	D2Mit266	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D2Mit266	a	128bp	B6.Cg-Lep^ob/+
	b	130bp	C57BL/6J
	c	132bp	BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt
	d	136bp	A/J, AKR/J, SPRET/EiJ
	e	138bp	C3H/HeJ, DBA/2J
	f	148bp	CAST/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D2Mit266	c	275bp	CBA/CaOlaHsd
	D2Mit266	s	220bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24