D5Mit62 Primer Detail MGI Mouse MGI:705727

D5Mit62 Primer Detail

Name

D5Mit62
Primer 1 Sequence

AACTTGCCTGCTGACCACTT
Primer 2 Sequence

TCAGAAGTGGGAGCTTTTGA
ID

MGI:705727
Product Size

206
Other IDs

D5Mit62 (BROAD)
Note

MIT assay: B678
Additional information: MIT STS Marker Data Files

D5Mit62

DNA segment, Chr 5, Massachusetts Institute of Technology 62

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D5Mit62	m	208bp	MOLF/EiJ
Not Specified	D5Mit62	s	216bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Endonuclease	Gene	Allele	Fragments	Strains
	D5Mit62	a	208bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	D5Mit62	b	216bp	CAST/EiJ, SPRET/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24