D10Mit213 Primer Detail MGI Mouse MGI:705729

D10Mit213 Primer Detail

Name

D10Mit213
Primer 1 Sequence

CTCCTCCTACTGATTGTCCCC
Primer 2 Sequence

GGGACAAACTTTTAAAAATTGCA
ID

MGI:705729
Product Size

150
Other IDs

D10Mit213 (BROAD)
Note

MIT assay: MJ4682
Additional information: MIT STS Marker Data Files

DNA segment, Chr 10, Massachusetts Institute of Technology 213

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit213	a	128bp	CAST/EiJ
	b	136bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, SPRET/EiJ
	c	150bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	156bp	AKR/J, NOD/MrkTac
	e	160bp	NON/ShiLt

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit213	c	lower	CBA/Kw
	D10Mit213	k	upper	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24