D4Mit244 Primer Detail MGI Mouse MGI:705733

D4Mit244 Primer Detail

Name

D4Mit244
Primer 1 Sequence

CAAAATATCTGACAAAAACAAGTGTG
Primer 2 Sequence

GGTGTCATCACCATGATGGA
ID

MGI:705733
Product Size

110
Other IDs

D4Mit244 (BROAD)
Note

MIT assay: MTAR4125
Additional information: MIT STS Marker Data Files

D4Mit244

DNA segment, Chr 4, Massachusetts Institute of Technology 244

J:50273 Poltorak A, et al., Blood Cells Mol Dis. 1998 Sep;24(3):340-55

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit244	h	not given	C3H/HeJ
	D4Mit244	s	not given	SWR

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit244	a	112bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J
	b	114bp	AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
	c	116bp	DBA/2J
	d	130bp	CAST/EiJ

J:54496 Rogers MJ, et al., Mamm Genome. 1999 May;10(5):513-9

Gene	Allele	Fragments	Strains
D4Mit244	a	0.11kb	CBA/Ca
	c	0.125kb	CAST/EiJ
	p	0.115kb	STOCK Whrn^wi
	w	0.125kb	STOCK Whrn^wi

J:50273 Poltorak A, et al., Genetic and physical mapping of the Lps locus: identification of the toll-4 receptor as a candidate gene in the critical region. Blood Cells Mol Dis. 1998 Sep;24(3):340-55

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:54496 Rogers MJ, et al., Genetic mapping of the whirler mutation. Mamm Genome. 1999 May;10(5):513-9

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24