D19Mit85 Primer Detail MGI Mouse MGI:705752

D19Mit85 Primer Detail

Name

D19Mit85
Primer 1 Sequence

ATGTGTGTGCTCCTTTTCCC
Primer 2 Sequence

TGAAAAAAAAAAAAAGATGTTGAGG
ID

MGI:705752
Product Size

257
Other IDs

D19Mit85 (BROAD)
Note

MIT assay: MT3734
Additional information: MIT STS Marker Data Files

D19Mit85

DNA segment, Chr 19, Massachusetts Institute of Technology 85

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit85	a	251bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	245bp	129X1/SvJ
		c	251, 253bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D19Mit85	b	smaller than f	C57BL/6J
	c	253bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit85	a	195bp	SPRET/EiJ
	b	208bp	CAST/EiJ
	c	238bp	AKR/J, BALB/cJ, DBA/2J
	d	251bp	A/J, LP/J
	e	253bp	C3H/HeJ, NOD/MrkTac, NON/ShiLt
	f	257bp	B6.Cg-Lep^ob/+, C57BL/6J

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit85	c	128bp	CBA/CaOlaHsd
	D19Mit85	s	124bp	SWR/OlaHsd

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 11/12/2024 MGI 6.24