About   Help   FAQ
D19Mit89 Primer Detail
Primers
  • Name
    D19Mit89
  • Primer 1 Sequence
    GCCCCGCTATTATAAATGCA
  • Primer 2 Sequence
    AGTATTTAGGGGAACACTAGTGTGTG
  • ID
    MGI:705756
  • Product Size
    131
  • Note
    MIT assay: MT3772
Genes
D19Mit89 DNA segment, Chr 19, Massachusetts Institute of Technology 89
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit89 a 120 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 128 129X1/SvJ
c 120, 122bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit89 a 114bp AKR/J, LP/J
b 118bp CAST/EiJ
c 120bp A/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac
d 122bp NON/ShiLt
e 128bp SPRET/EiJ
f 130bp B6.Cg-Lepob/+, C57BL/6J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D19Mit89 l smaller LG/J
s larger SM/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D19Mit89 c 123bp CBA/CaOlaHsd
s 111bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
06/12/2024
MGI 6.13 		The Jackson Laboratory