D10Mit38 Primer Detail MGI Mouse MGI:705779

D10Mit38 Primer Detail

Name

D10Mit38
Primer 1 Sequence

CGATGAGCCCTAACACCAAT
Primer 2 Sequence

CCTGTTACAAACTAAACCAAACCC
ID

MGI:705779
Product Size

149
Other IDs

D10Mit38 (BROAD)
Note

MIT assay: B393
Additional information: MIT STS Marker Data Files

D10Mit38

DNA segment, Chr 10, Massachusetts Institute of Technology 38

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D10Mit38	a	160bp	A/J, BALB/cJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	b	166bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	178bp	LP/J
	d	188bp	CAST/EiJ, SPRET/EiJ
	e	196bp	AKR/J, C3H/HeJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D10Mit38	c	149bp	A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, PWB, SJL/J
	d	145bp	DBA/2J
	g	169bp	129P3/J
	j	173bp	JF1

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D10Mit38	a	larger	129P3/J
	D10Mit38	s	smaller	SJL/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24