D1Mit166 Primer Detail MGI Mouse MGI:705825

D1Mit166 Primer Detail

Name

D1Mit166
Primer 1 Sequence

GATGAAGTGAAAATGATCCTTGC
Primer 2 Sequence

TATCTTTTGTGGACTCGGGG
ID

MGI:705825
Product Size

121
Other IDs

D1Mit166 (BROAD)
Note

MIT assay: MT930
Additional information: MIT STS Marker Data Files

D1Mit166

DNA segment, Chr 1, Massachusetts Institute of Technology 166

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit166	a	108bp	AKR/J, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac, NON/ShiLt
	b	123bp	A/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	c	125bp	CAST/EiJ
	d	139bp	SPRET/EiJ

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit166	a	smaller	129P3/J
	D1Mit166	s	larger	SJL/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit166	a	123bp	129/SvW, A.CA/W, BN/aW, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	D1Mit166	b	108bp	AKR/W, BALB/cW, C3H/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24