D18Mit40 Primer Detail MGI Mouse MGI:705836

D18Mit40 Primer Detail

Name

D18Mit40
Primer 1 Sequence

GGTAGGAGTCACTTTCCGTCC
Primer 2 Sequence

TTTTGTGAGCATTTTTATACCATT
ID

MGI:705836
Product Size

140
Other IDs

D18Mit40 (BROAD)
Note

MIT assay: B561
Additional information: MIT STS Marker Data Files

D18Mit40

DNA segment, Chr 18, Massachusetts Institute of Technology 40

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit40	a	132bp	129X1/Sv
Not Specified	D18Mit40	f	136bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit40	a	132bp	A/J, BALB/cJ, C3H/HeJ
	b	142bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	158bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D18Mit40	c	130bp	A/JOlaHsd, BALB/cJ, C3H/HeJ
	d	140bp	AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, DBA/2J, JF1, SJL/J
	g	134bp	129P3/J
	p	158bp	PWB

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24