D11Mit8 Primer Detail MGI Mouse MGI:705867

D11Mit8 Primer Detail

Name

D11Mit8
Primer 1 Sequence

CTTTTCATGGAGGCACAGGT
Primer 2 Sequence

TGTGAACAGAGACACACATTCA
ID

MGI:705867
Product Size

154
Other IDs

D11Mit8 (BROAD)
Note

MIT assay: M212
Additional information: MIT STS Marker Data Files

D11Mit8

DNA segment, Chr 11, Massachusetts Institute of Technology 8

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit8	a	133bp	AKR/J, BALB/cJ
	b	155bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	170bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit8	l	larger	LG/J
	D11Mit8	s	smaller	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D11Mit8	a	155bp	129/SvW, A.CA/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	b	133bp	BALB/cW
	c	130bp	AKR/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24