D11Mit7 Primer Detail MGI Mouse MGI:705868

D11Mit7 Primer Detail

Name

D11Mit7
Primer 1 Sequence

AGGGTATTCTCTAGCCTCCACAC
Primer 2 Sequence

TTTGAGGCAAGATGTCATGTATG
ID

MGI:705868
Product Size

147
Other IDs

D11Mit7 (BROAD)
Note

MIT assay: M119
Additional information: MIT STS Marker Data Files

D11Mit7

DNA segment, Chr 11, Massachusetts Institute of Technology 7

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D11Mit7	m	148bp	MOLF/EiJ
Not Specified	D11Mit7	s	172bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit7	a	144bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	b	148bp	CAST/EiJ
	c	172bp	SPRET/EiJ

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/09/2024 MGI 6.24