About   Help   FAQ
D11Mit5 Primer Detail
Primers
  • Name
    D11Mit5
  • Primer 1 Sequence
    TTCTGTGAGCCTGGAGGAGT
  • Primer 2 Sequence
    TACAGGACTAGTTTCCATTTGGG
  • ID
    MGI:705869
  • Product Size
    220
  • Other IDs
    D11Mit5 (BROAD)
  • Note
    MIT assay: A2
    Additional information: MIT STS Marker Data Files
Genes
D11Mit5 DNA segment, Chr 11, Massachusetts Institute of Technology 5
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit5 a largest C57BL/6
b smaller DBA/2, JF1, MSM/Ms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit5 a 142bp CAST/EiJ
b 176bp NON/ShiLt
c 181bp LP/J, NOD/MrkTac
d 186bp BALB/cJ, C3H/HeJ
e 187bp DBA/2J
f 212bp A/J, AKR/J
g 219bp B6.Cg-Lepob/+, C57BL/6J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D11Mit5 l smaller LG/J
s larger SM/J
J:156851 Golas A, MGI Direct Data Submission. 2010;
Endonuclease Gene Allele Fragments Strains
D11Mit5 b upper C57BL/6J
s lower 129/Sv
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/10/2024
MGI 6.24 		The Jackson Laboratory