D8Mit80 Primer Detail MGI Mouse MGI:705891

D8Mit80 Primer Detail

Name

D8Mit80
Primer 1 Sequence

TGCATTTGTCAGGGCTCTC
Primer 2 Sequence

ATGACACATGAGCCTCCACA
ID

MGI:705891
Product Size

107
Other IDs

D8Mit80 (BROAD)
Note

MIT assay: MPC1033
Additional information: MIT STS Marker Data Files

D8Mit80

DNA segment, Chr 8, Massachusetts Institute of Technology 80

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D8Mit80	a	108bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J
	b	124bp	AKR/J, BALB/cJ, CAST/EiJ, LP/J, NOD/MrkTac
	c	134bp	A/J, C3H/HeJ, NON/ShiLt, SPRET/EiJ

J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;

Endonuclease	Gene	Allele	Fragments	Strains
	D8Mit80	c	upper	CBA/Kw
	D8Mit80	e	lower	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/10/2024 MGI 6.24