About   Help   FAQ
D6Mit74 Primer Detail
Primers
  • Name
    D6Mit74
  • Primer 1 Sequence
    CATGTGCAGTGTAAGTAAGACCTC
  • Primer 2 Sequence
    TCTCCTCCATCCTTCTCCAT
  • ID
    MGI:705900
  • Product Size
    150
  • Other IDs
    D6Mit74 (BROAD)
  • Note
    MIT assay: MPC1322
    Additional information: MIT STS Marker Data Files
Genes
D6Mit74 DNA segment, Chr 6, Massachusetts Institute of Technology 74
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D6Mit74 b larger C57BL/6J
f smaller FVB/N
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit74 a largest JF1, MSM/Ms
b smaller C57BL/6
c smallest DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit74 a 130bp AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
b 132bp A/J, NON/ShiLt
c 144bp SPRET/EiJ
d 150bp B6.Cg-Lepob/+, C57BL/6J, LP/J
e 182bp CAST/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory